VoiceSync.org misc tools
![]()
This section contains miscellaneous tools:
|
This
program contains a set of 14 combinations of frequencies applicable to a
selectable list of more than 400 diseases. Hearing periodically these
combinations of frequencies can help the healing process.
|
||
|
Reads
161 star spectrum of 161 stars of spectral types O through M and
luminosity classes I, III, and V. Most stars are of solar metallicity,
although two were chosen specifically for low metallicity. The data were
obtained with the Intensified Reticon Scanner on the #1 91-cm telescope at
Kitt Peak National Observatory.
Sound is generated directly from this digital spectra data, appearing ancient drum rhythms of different types, octave distribution and volume can be controlled through sliders.
|
||
|
Inputs
a JCAMP-DX files from ISIS Pulsed Neutron & Muon Source Instruments & Support Molecular Spectroscopy Tosca
and generates a compound sound based on substance spectrum.
|
||
|
Generates
a compound binaural tone from each drug's atomic weight. More that 1800
drugs are loaded from a JCAMP file included. Search by name facility
is also implemented.
|
||
|
Generates
from nucleotide (ATCG) genetic sequences in FAST format available from www.ncbi.nlm.nih.gov
at 8 bit, mono, 8000 samp./sec resolution. Download a human genome
sequence from this site in FAST format (FCGI extension) and open it
from this program. Sound is created coding each nucleotide ATGC to a binary pair with selectable combination, i.e. A=00, T=01, G=10, C=11. Don't expect hearing something harmonic, sound is generated directly from genetic information 'as is' this produces a quite draft noise. Some examples from human chromosome #3 are included in zip file. Human genome contains 24 chromosomes pairs 22+X+Y. Format of FAST files is quite simple, it's a text file with one line header following the nucleotide sequence in 70 char blocks, i.e. ATACGGGAGAACTAAGGCTGAAACCTCGGAGGAACAACCACTTTTGAAGTGACTTCGCGGCGTGCGTTGG
|
||
|
Experience
3d animation of the platonic solids with selectable depth and angle. Must
have OpenGL installed in your system
(this should be quite usual).
|
||
|
Generates
resonant three octave compound tones from a list of more than 3000
minerals. Tones are generated using powder X-ray Diffraction parameters.
This is one of the primary techniques used by mineralogists and solid
state chemists to examine the physico-chemical make-up of unknown solids.
This data is represented in a collection of single-phase X-ray powder
diffraction patterns for the three most intense interplanar spacings.
|
||
|
Hear
the sound of the solar system at a selected date, includes controls for
easy change of actual date, provides a simplified trace map of planets.
Provides a data grid with planets actual position in heliocentric coordinates (ecliptic loc.) and distance to sun in au. Sound is generated from physical and orbital data. Operation is simple: just select the day and click on the play button (toggles play/stop), other controls are self explanatory.
|
||
|
This
program generates complex tones from molecular atoms and geometry, taking
as input one of the thousand .pdb files from Protein
databank, generates a sound as a listener would hear located in front
of the molecule, being the atoms resonant points at atomic mass frequency
shifted to octave cero. The final effect is like listening the vibration
of the molecule.
Are the properties of the molecule contained in the vibration of its sound? Usage: 1. Download from Protein databank the molecule you want to generate, important: use the .PDB format for downloading. 2. Open the .pdb file in the program. 3. Select the number of atoms, in a 1GHz computer less than 400 atoms can be processed in real time, when computer is saturated the program issues a beep-beep tone and hangs-up, default value is 300 atoms. 4. Generate the full molecule sound with the write .WAV option, molecule sound rendering is a extremely high computational intensive process, this option generates 10" of selected atoms, no restriction applies here only the amount on time required. Typical rates are 1 minute of rendering per second of sound.
|
||
See the colors of twelve musical notes and hear them in different octaves
|
|
||
|
VoiceRings and Lissajous figures are dynamically generated while talking. |
|
||
|
|
|
||
|
|
|
||
|
|
|
||
|
|
|
||
|
|
|
||
|
Spectrum data can be copied to clipboard in a two column table containing (Hz, Power 0..100), enabling pasting from MS-Excel® or any text editor. |
|
John Harrison, this remarkable gentleman (1693-1776) had the fascinating idea of defining a musical scale based in PI number, more precisely in (2^(1/(2*PI))), instead of 2^(1/12) in temperate one, defining two constants for musical fifth (1.494411510) and fourth (1.338319457). Temperate scale seems to be in the middle of Harrison's fifth & fourth, being a compromise between them. Was J.S.Bach (1698-1750) aware of this scale? and its consequences in modern music harmony? Charles E. H. Lucy has designed a guitar based in these scales with surprising results you can check in his web site. Could this new way of understanding harmony change our conception of music? In this implementation you can select a note played as a single tone or a major chord (tone+fifth+third), both Harrison scales seem to sound better and more harmonically, it might be difficult to appreciate at the beginning but after a short while you can feel it. |
|
| VoiceRings. Talk and see animated concentric color rings following your voice, colors and number of rings are calculated from frequency and number of voice formants. |
|
|
GeoStar. Generate geometric stars with three type of connections (star, polygon, all2all), number of vertices from 3 to 200, result can be copied to clip.
|
|
![]()